Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Full text not archived in this repository.

Please see our End User Agreement.

It is advisable to refer to the publisher's version if you intend to cite from this work. See Guidance on citing.

Add to AnyAdd to TwitterAdd to FacebookAdd to LinkedinAdd to PinterestAdd to Email

Leal, R. M. F., Callow, S., Callow, P., Blakeley, M. P., Cardin, C. J. ORCID: https://orcid.org/0000-0002-2556-9995, Denny, W. A., Teixeira, S. C. M., Mitchell, E. P. and Forsyth, V. T. (2010) Combined neutron and X-ray diffraction studies of DNA in crystals and solutions. Acta Crystallographica Section D - Biological Crystallography, 66 (11). pp. 1244-1248. ISSN 1399-0047 doi: 10.1107/S0907444910017713

Abstract/Summary

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Altmetric Badge

Dimensions Badge

Item Type Article
URI https://reading-pure-test.eprints-hosting.org/id/eprint/147296
Identification Number/DOI 10.1107/S0907444910017713
Refereed Yes
Divisions Life Sciences > School of Chemistry, Food and Pharmacy > Department of Chemistry
Central Services
Download/View statistics View download statistics for this item

University Staff: Request a correction | Centaur Editors: Update this record